Detail of EST/Unigene SRR546172.135045 |
Acc. | SRR546172.135045 |
Internal Acc. | G2HQ8GE01EF071 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=3e-25; Chlorophyll a-b binding protein AB10, chloroplastic OS=Malus domestica E-value=5e-25; Chlorophyll a-b binding protein type 2 member 2 (Fragment) OS=Pinus sylvestris E-value=2e-23; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-18; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-18; |
Length | 230 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172; |
Sequence | TCGCGATGGGCCATGCTCGGTCGCTCTGGGCTGTGTCTTCCCCGAACTCTTGGCCCGCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |