Detail of EST/Unigene SRR546172.143280 |
Acc. | SRR546172.143280 |
Internal Acc. | G2HQ8GE01BYDVX |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=2e-35; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=3e-35; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-34; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-34; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=3e-34; |
Length | 263 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172; |
Sequence | ATGTCATGGGCGAGGGCCGAATCACCATGAGAAAGGCTGCAGCTAAACCCAAGAAAGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |