| Detail of EST/Unigene SRR546172.151843 |
| Acc. | SRR546172.151843 |
| Internal Acc. | G2HQ8GE01DFISO |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=7e-31; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=3e-30; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=4e-30; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=4e-30; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=6e-30; |
| Length | 204 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172; |
| Sequence | CGCGAGTGGATGACCTCCAGCTCTCGGTTCTTGGCGAAGGTCTCGGGATCAGCCGAAAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |