Detail of EST/Unigene SRR546172.152166 |
Acc. | SRR546172.152166 |
Internal Acc. | G2HQ8GE01EZV1R |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-10; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=7e-10; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=3e-09; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-09; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=6e-09; |
Length | 267 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172; |
Sequence | ACGGCCGGGGGGGATCCCAAGGAGAACAAAGCTTGAAACTTCTCTTCTCTTTAATTGCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |