Detail of EST/Unigene SRR546172.156954 |
Acc. | SRR546172.156954 |
Internal Acc. | G2HQ8GE01B4TRI |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=4e-20; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-19; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-19; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=1e-18; |
Length | 249 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172; |
Sequence | CTTGCATCAGCAACGGTGATTGAGATGTTAAGCGCTTGCAGAAGATACAGCTGCTGCTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |