| Detail of EST/Unigene SRR546172.167833 |
| Acc. | SRR546172.167833 |
| Internal Acc. | G2HQ8GE01CVOOK_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=5e-13; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=9e-13; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=9e-13; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=1e-12; Cysteine synthase OS=Brassica juncea E-value=1e-12; |
| Length | 148 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172; |
| Sequence | CTCAGCTCCAAAAGGCTAGGAGCACAATTCTTCTTTCGACACTGTAAGAACTTGGCATAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |