| Detail of EST/Unigene SRR546172.169562 |
| Acc. | SRR546172.169562 |
| Internal Acc. | G2HQ8GE01EVS9L_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=9e-10; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=9e-10; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=9e-10; Chlorophyll a-b binding of LHCII type 1 protein (Fragment) OS=Raphanus sativus E-value=9e-10; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=9e-10; |
| Length | 94 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172; |
| Sequence | CCCCTCTACAGCTCCCATTAAGATCATTTGAGTCGCCCAAATCGCTAAAATGCTCTGAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |