Detail of EST/Unigene SRR546172.169562 |
Acc. | SRR546172.169562 |
Internal Acc. | G2HQ8GE01EVS9L_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=9e-10; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=9e-10; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=9e-10; Chlorophyll a-b binding of LHCII type 1 protein (Fragment) OS=Raphanus sativus E-value=9e-10; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=9e-10; |
Length | 94 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172; |
Sequence | CCCCTCTACAGCTCCCATTAAGATCATTTGAGTCGCCCAAATCGCTAAAATGCTCTGAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |