| Detail of EST/Unigene SRR546172.25710 |
| Acc. | SRR546172.25710 |
| Internal Acc. | G2HQ8GE01AO53V_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 3, mitochondrial OS=Glycine max E-value=2e-31; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=1e-30; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=3e-29; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=1e-28; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=1e-28; |
| Length | 268 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172; |
| Sequence | TCAATATATATGTATATATATCCTCAATGGTATGTATATATCATCAATATATATGTATAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |