Detail of EST/Unigene SRR546172.26046
Acc. SRR546172.26046
Internal Acc. G2HQ8GE01AEQFC
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Spinacia oleracea E-value=3e-14; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Vigna radiata var. radiata E-value=6e-14; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-14; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Malus domestica E-value=6e-14; Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic OS=Hordeum vulgare E-value=6e-14;
Length 110 nt
Species Humulus lupulus
Belonged EST Libraries SRR546172;
Sequence TCAGTCTTGAAGATTCCAATGCAAACACCAATCCGGTCATCCCTAGTAGGAGCCCAGTAG
AATTTCTCCATACGACCGTCACGAATGAGAGGTGCATACAAAGTTGAGAA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A