Detail of EST/Unigene SRR546172.39955 |
Acc. | SRR546172.39955 |
Internal Acc. | G2HQ8GE01AZGHG |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=5e-55; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=6e-55; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=3e-54; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=6e-53; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=7e-53; |
Length | 390 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172; |
Sequence | CTGATGGAGGGCCTTGGAGGAGATTGTGTGCTCTGCCCGCGTTATGGGTAGGTTTGTTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |