| Detail of EST/Unigene SRR546172.41048 |
| Acc. | SRR546172.41048 |
| Internal Acc. | G2HQ8GE01AMLAW |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=3e-56; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=5e-56; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=4e-53; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=1e-51; Alternative oxidase 3, mitochondrial OS=Arabidopsis thaliana E-value=8e-51; |
| Length | 342 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172; |
| Sequence | GTAATGACATCTTTAAGGGTTGCGTCCTTTGGTAATCTCCAGTAGTCAATTGCAATGGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |