| Detail of EST/Unigene SRR546172.45454 |
| Acc. | SRR546172.45454 |
| Internal Acc. | G2HQ8GE01CNRSH_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide synthase OS=Parthenium argentatum E-value=1e-17; Allene oxide synthase, chloroplastic OS=Linum usitatissimum E-value=3e-17; Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-14; Allene oxide synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-13; 9-divinyl ether synthase OS=Nicotiana tabacum E-value=3e-12; |
| Length | 137 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172; |
| Sequence | AAGCTTCTCGCCCTCGCCCACGAACCGATCCGGAACGAACTCCTCGGGTCGGTCGAATAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |