| Detail of EST/Unigene SRR546172.60061 |
| Acc. | SRR546172.60061 |
| Internal Acc. | G2HQ8GE01EB01U |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=7e-57; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=1e-56; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=1e-53; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=7e-52; Alternative oxidase 3, mitochondrial OS=Arabidopsis thaliana E-value=5e-51; |
| Length | 344 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172; |
| Sequence | GTAATGACATCTTTAAGGGTTGCGTCCTTTGGTAATCTCCAGTAGTCAATTGCAATGGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |