Detail of EST/Unigene SRR546172.92678 |
Acc. | SRR546172.92678 |
Internal Acc. | G2HQ8GE01DS1C6 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=4e-30; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=2e-29; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=2e-29; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-29; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-29; |
Length | 205 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172; |
Sequence | GCGGGCCAAGAGTTCGGGGAAGACACAGCCCAGAGCGCCGAGCATGGCCCATCGCGAGTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |