| Detail of EST/Unigene TCAA50374 |
| Acc. | TCAA50374 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Petunia hybrida E-value=0; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Arabidopsis thaliana E-value=0; Aspartate aminotransferase OS=Pinus pinaster E-value=0; Aspartate aminotransferase OS=Rickettsia bellii (strain RML369-C) E-value=4e-79; Aspartate aminotransferase OS=Rickettsia prowazekii (strain Madrid E) E-value=8e-79; |
| Length | 2457 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAZI (3 ESTs); |
| Sequence | CAAATATCCAGCATTGTTTCTTCTTCTTCTTCTTCAAAAGGAGGCGCCTCCTCCTCATTC |
| EST members of Unigene | EY040063 EY040064 EY032766 EY060040 EY060041 EY040401 EY040400 EY034630 EY034629 EY050566 EY050565 EY055818 EY055817 EY066696 EY066697 EY090562 EY090561 EY044264 EY044263 EY085454 EY085453 EY044760 EY044759 EY054505 EY041595 EY054504 EY041594 EY113234 EY036217 EY058142 EY058141 GW329516 EY100265 EY100264 EY032895 EY032894 EY078706 EY078705 EY052494 EY043728 EY043727 EY045313 EY045314 EY036216 EY063085 EY054937 EY034562 EY054936 EY034561 EY093709 EY093708 EY069180 EY069179 EY062708 EY062707 EY034687 EY057930 EY103800 EY073078 EY058381 EY103799 EY073077 EY060024 EY081178 EY110839 GW328204 GW328408 EY081177 EY054296 EY058382 EY063172 EY051284 EY057929 EY051283 EY084278 EY052485 EY038820 GW328849 EY038819 EY034805 EY100176 EY100175 EY063173 EY054295 EY052653 EY052453 EY051342 EY035560 EY051341 EY035559 EY052207 EY053683 EY052206 EY053682 EY046183 EY052654 EY046182 EY052454 EY106130 EY069444 EY050843 EY050842 EY092989 EY069443 EY092988 EY056584 EY056583 EY055156 EY055155 EY061794 EY061793 EY106131 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.6.1.- 2.6.1.7 4.4.1.13 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816758 |
| Trichome-related Gene from Literature | 816758 |