Detail of EST/Unigene TCAA50982 |
Acc. | TCAA50982 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Aquaporin TIP2-1 OS=Arabidopsis thaliana E-value=6e-86; Probable aquaporin TIP-type OS=Antirrhinum majus E-value=3e-83; Probable aquaporin TIP-type RB7-5A OS=Nicotiana tabacum E-value=7e-82; Probable aquaporin TIP-type RB7-18C OS=Nicotiana tabacum E-value=2e-81; Aquaporin TIP2-1 OS=Zea mays E-value=4e-81; |
Length | 962 nt |
Species | Artemisia annua |
Belonged EST Libraries | LIBEST_025692 (1 ESTs); |
Sequence | TCTCACTCATAATTTAATTTAATTTTTGAGTAGCTCCCAATATTTTTATTAAAAATGCCT |
EST members of Unigene | EY091741 EY078957 EY091740 EY100922 EY078802 EY078801 EY078958 EY035829 EY035830 EY115365 EY115366 EY099379 EY099380 EY111117 EY074823 EY074822 EY083908 EY089240 EY083909 EY089241 EY038254 EY100921 EY079996 EY091783 EY080385 EY091784 EY080386 EY076379 EY076380 EY115097 EY111118 EY078689 EY089524 EY086668 EY089525 EY107804 EY107805 EY044143 EY044144 EY105826 EY105827 GW329250 EY098250 EY098251 EY115096 EY086667 EY111720 EY111719 EY078690 EY075332 EY075333 EY079498 EY070770 EY070771 EY079499 EY073345 EY095565 EY073346 EY095566 EY081882 EY081883 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.A.8 Major intrinsic protein MIP |
Probeset |
|
Corresponding NCBI Gene | 820870 |
Trichome-related Gene from Literature | 820870 |