| Detail of EST/Unigene TCAA51375 |
| Acc. | TCAA51375 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Metallothionein-like protein 1 OS=Mimulus guttatus E-value=9e-18; Metallothionein-like protein type 2 OS=Nicotiana plumbaginifolia E-value=2e-11; Metallothionein-like protein type 2 OS=Solanum lycopersicum E-value=3e-11; Metallothionein-like protein type 2 OS=Solanum lycopersicum E-value=1e-10; Metallothionein-like protein type 2 OS=Actinidia deliciosa E-value=1e-10; |
| Length | 584 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | |
| Sequence | AATTAAACACCATTTTTTTTTAAATACTCCATAGTCCATACTCATACCTTTTCTCTAACA |
| EST members of Unigene | EY060819 EY038399 GW328721 EY060820 EY051080 EY038400 EY033563 EY069907 EY069906 GW329124 EY064935 EY064934 GW329323 EY057075 GW328490 EY057074 GW328724 GW328300 GW329368 EY040042 EY049246 EY049245 EY049401 EY049400 EY061947 GW328739 GW328731 EY055952 EY055951 GW328095 GW328515 GW328513 GW329134 GW328958 EY067667 EY056367 EY052250 EY115040 GW328245 EY050017 EY051079 EY050016 EY037458 EY037457 EY055480 EY055479 GW328868 EY055478 EY055477 EY052249 EY059673 EY056368 EY067666 EY066146 EY066145 EY062942 EY062941 EY066140 EY066139 GW328267 GW328475 GW328892 GW328681 GW329517 GW328884 EY059674 GW328883 EY054963 EY061177 GW328409 EY088905 EY088904 GW328201 EY061948 GW328198 GW328402 GW329674 GW328613 GW329027 GW329441 GW328816 EY053565 EY053564 GW328809 EY065378 EY065379 EY054962 EY061176 GW329482 EY065300 EY065299 GW328426 EY057311 EY050120 EY057310 EY050119 EY065838 GW328843 EY065837 EY039229 GW328837 EY049955 EY056093 EY053842 GW328568 EY051702 GW329185 EY051701 GW328976 EY061474 EY064941 EY061473 EY064940 EY040043 GW329598 EY054233 EY054232 EY056094 EY053843 GW328362 EY057887 EY049954 EY057886 EY115039 GW328378 GW329411 GW329410 GW329636 EY061711 EY061708 GW328575 EY061709 EY115223 EY061710 EY115224 GW328163 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831816 |
| Trichome-related Gene from Literature | 831816 |