Detail of EST/Unigene TCHL50021 |
Acc. | TCHL50021 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=2e-43; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=4e-43; Gamma-glutamyltranspeptidase 1 OS=Homo sapiens E-value=6e-43; Gamma-glutamyltranspeptidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-42; Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=1e-42; |
Length | 1096 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170 (9 ESTs); SRR546172 (6 ESTs); SRR546165 (6 ESTs); SRR546168 (4 ESTs); |
Sequence | GGATGCCATGGTTGCAAATGTAATGGGCTACACTGTATATGGGATGCCACCACCTTCCAG |
EST members of Unigene | SRR546170.49481 SRR546170.147233 SRR546170.61833 SRR546165.302415 SRR546170.21817 SRR546165.311714 SRR546165.45438 SRR546165.73845 SRR546170.82535 SRR546170.28246 SRR546168.8560 SRR546165.168553 SRR546170.11190 SRR546165.264132 SRR546170.98681 SRR546165.165085 SRR546172.25437 SRR546172.48053 SRR546172.120723 SRR546168.37182 SRR546172.15408 SRR546170.32352 SRR546165.54815 SRR546168.9227 SRR546172.166557 SRR546172.83274 SRR546168.79731 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
EC | 2.3.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829042 |
Trichome-related Gene from Literature | 829042 |