Detail of EST/Unigene TCHL50092 |
Acc. | TCHL50092 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Xyloglucan endotransglucosylase/hydrolase protein 22 OS=Arabidopsis thaliana E-value=0; Probable xyloglucan endotransglucosylase/hydrolase protein 25 OS=Arabidopsis thaliana E-value=0; Xyloglucan endotransglucosylase/hydrolase protein 24 OS=Arabidopsis thaliana E-value=0; Brassinosteroid-regulated protein BRU1 OS=Glycine max E-value=0; Probable xyloglucan endotransglucosylase/hydrolase protein 16 OS=Arabidopsis thaliana E-value=0; |
Length | 993 nt |
Species | Humulus lupulus |
Belonged EST Libraries | |
Sequence | TTCAGCAAATTTGTTTGCGGTCTTTGTGGTGTTTTGCATGGTTGTTGTTAGTGCTTCAGC |
EST members of Unigene | SRR546170.22579 SRR546170.166531 SRR546170.70699 SRR546170.62393 SRR546170.21821 GD244292 SRR546170.24334 SRR546172.138803 SRR546172.149993 SRR546170.54656 SRR546170.100809 SRR546172.87371 SRR546168.100830 SRR546170.65656 SRR546170.67976 SRR546170.16774 SRR546170.25279 SRR546170.137524 SRR546170.22991 SRR546170.51981 SRR546170.93899 SRR546170.158287 SRR546170.94326 SRR546170.162539 SRR546172.135378 SRR546170.26699 SRR546170.44473 SRR546170.136416 SRR546170.1950 SRR546172.122211 SRR546172.124719 SRR546170.149940 SRR546170.28607 SRR546170.2331 SRR546170.86180 SRR546170.93710 SRR546170.132154 SRR546172.72148 SRR546170.47777 SRR546172.158188 SRR546170.153693 SRR546170.100166 GD249193 SRR546170.158325 GD247601 SRR546170.108470 SRR546170.1436 SRR546170.1047 SRR546172.92519 SRR546165.276220 SRR546170.850 SRR546170.54752 SRR546170.129127 SRR546170.27308 SRR546172.96949 SRR546172.138485 SRR546170.125063 SRR546170.49751 SRR546170.15740 SRR546170.124130 GD249822 SRR546170.56750 SRR546170.130741 SRR546170.8447 SRR546170.154129 SRR546170.122251 SRR546170.114331 SRR546172.111331 SRR546170.113539 SRR546170.97689 SRR546170.40870 SRR546170.102110 SRR546172.57560 SRR546170.84537 SRR546170.108494 SRR546170.148103 SRR546170.109276 SRR546170.140767 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835860 |
Trichome-related Gene from Literature | 835860 |