| Detail of EST/Unigene TCHL51617 |
| Acc. | TCHL51617 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ABC transporter C family member 5 OS=Arabidopsis thaliana E-value=2e-52; ABC transporter C family member 3 OS=Arabidopsis thaliana E-value=1e-39; ABC transporter C family member 9 OS=Arabidopsis thaliana E-value=3e-36; Putative ABC transporter C family member 15 OS=Arabidopsis thaliana E-value=3e-36; ABC transporter C family member 6 OS=Arabidopsis thaliana E-value=8e-35; |
| Length | 942 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | |
| Sequence | TGAGACAATAGACAAATTCCTACAAAAATTTCCCCATGAATGAAAACATGGGGATGTGGA |
| EST members of Unigene | SRR546172.51458 SRR546165.141447 SRR546170.58542 SRR546170.15838 SRR546165.176421 SRR546165.6342 SRR546172.158497 SRR546165.248489 SRR546172.98217 SRR546168.62590 SRR546165.173496 SRR546168.115327 SRR546168.16440 SRR546172.12626 SRR546172.110040 SRR546165.135891 SRR546165.108055 SRR546172.108707 SRR546165.14125 SRR546172.161636 SRR546165.107270 SRR546165.8324 SRR546165.131810 SRR546165.270948 SRR546172.128397 SRR546172.92292 SRR546172.146214 SRR546165.60393 SRR546165.266787 SRR546172.103749 SRR546165.66183 SRR546165.94776 SRR546165.148883 SRR546165.227151 SRR546165.270623 SRR546168.65203 SRR546165.96497 SRR546165.173401 SRR546168.113491 SRR546172.26074 SRR546165.84558 SRR546170.19633 SRR546172.80611 SRR546172.54334 SRR546168.6931 SRR546165.9997 SRR546172.28425 SRR546172.33062 SRR546165.316277 SRR546165.97910 SRR546170.52101 SRR546172.116140 SRR546172.102615 SRR546165.106209 SRR546165.76262 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05668 ATP-binding cassette, subfamily C (CFTR/MRP), member 5; Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05673 ATP-binding cassette, subfamily C (CFTR/MRP), member 4 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea) |
| Probeset |
|
| Corresponding NCBI Gene | 839277 |
| Trichome-related Gene from Literature | 839277 |