| Detail of EST/Unigene TCHL52254 |
| Acc. | TCHL52254 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone reductase homolog P3 OS=Arabidopsis thaliana E-value=0; Isoflavone reductase homolog OS=Solanum tuberosum E-value=0; Isoflavone reductase homolog A622 OS=Nicotiana tabacum E-value=0; Isoflavone reductase homolog IRL OS=Zea mays E-value=0; Isoflavone reductase OS=Medicago sativa E-value=9e-99; |
| Length | 1167 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (44 ESTs); SRR546168 (2 ESTs); |
| Sequence | TCCAATATAACACAGGTTTTTTCTTATTACTTCATGAAAAAACTACACAATACAAGCTCA |
| EST members of Unigene | SRR546165.194765 SRR546165.157086 SRR546168.105295 SRR546165.282309 SRR546165.308587 SRR546165.284828 SRR546172.8550 SRR546165.274011 SRR546165.299889 SRR546165.93506 SRR546165.104126 SRR546165.95806 SRR546168.53686 SRR546165.220070 SRR546165.46922 SRR546165.268003 SRR546172.88154 SRR546165.40168 SRR546165.131184 SRR546165.281550 SRR546165.82900 SRR546165.278657 SRR546165.115966 SRR546165.317135 SRR546165.302256 SRR546165.135300 SRR546165.24180 SRR546165.239080 SRR546165.198883 SRR546165.68057 SRR546165.243129 SRR546168.79256 SRR546165.89859 SRR546165.243876 SRR546165.110336 SRR546172.95929 SRR546165.78079 SRR546165.59911 SRR546165.63012 SRR546165.72099 SRR546165.122360 SRR546165.131357 SRR546165.234260 SRR546165.96871 SRR546165.142097 SRR546165.230415 SRR546165.302681 SRR546165.184420 SRR546165.122387 SRR546165.283755 SRR546165.21717 SRR546172.63318 SRR546165.312912 SRR546170.71928 SRR546165.82949 SRR546165.277356 SRR546165.88559 SRR546165.66139 SRR546172.123414 SRR546165.171073 SRR546165.102081 SRR546172.93681 SRR546165.34100 SRR546165.111388 SRR546165.135974 SRR546165.144094 SRR546165.98871 SRR546165.325369 SRR546165.158217 SRR546165.305463 SRR546165.274553 SRR546168.103334 SRR546165.174615 SRR546165.259067 SRR546165.254621 SRR546165.292849 SRR546165.178266 SRR546165.270066 SRR546172.119216 SRR546165.115662 SRR546165.127456 SRR546165.230849 SRR546165.56345 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843865 |
| Trichome-related Gene from Literature | 843865 |