Detail of EST/Unigene TCHL52691 |
Acc. | TCHL52691 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Salicylate O-methyltransferase OS=Clarkia breweri E-value=3e-67; Jasmonate O-methyltransferase OS=Brassica rapa subsp. pekinensis E-value=3e-64; Jasmonate O-methyltransferase OS=Arabidopsis thaliana E-value=4e-63; Benzoate carboxyl methyltransferase OS=Antirrhinum majus E-value=2e-59; Caffeine synthase 1 OS=Camellia sinensis E-value=2e-56; |
Length | 1010 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168 (3 ESTs); SRR546172 (2 ESTs); SRR546170 (1 ESTs); |
Sequence | CTGAAACATATTTTCCTCTCTTCTGCATGTCATTGTTATTATTGTCTATTTTGGAAGTAT |
EST members of Unigene | SRR546168.103555 SRR546172.55897 SRR546168.102971 SRR546172.136078 SRR546170.127096 SRR546172.88148 SRR546170.90960 SRR546168.87685 SRR546172.151553 SRR546172.123750 SRR546168.22628 SRR546170.107083 SRR546170.95485 SRR546168.72886 SRR546172.124353 SRR546168.71528 SRR546172.66955 SRR546170.123675 SRR546170.99126 SRR546170.96165 SRR546172.5608 SRR546168.52073 SRR546172.115329 SRR546172.135797 SRR546168.109635 SRR546165.40837 SRR546170.61507 SRR546168.128368 SRR546172.157215 SRR546172.70310 SRR546172.129059 SRR546168.124355 SRR546168.30293 SRR546170.45155 SRR546172.106869 SRR546172.9846 SRR546168.76840 SRR546172.547 SRR546170.54023 SRR546168.129188 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838551 |
Trichome-related Gene from Literature | 838551 |