| Detail of EST/Unigene TCHL52775 |
| Acc. | TCHL52775 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Transcription factor TGA2 OS=Arabidopsis thaliana E-value=0; Transcription factor TGA6 OS=Arabidopsis thaliana E-value=0; Transcription factor HBP-1b(c1) (Fragment) OS=Triticum aestivum E-value=0; Transcription factor HBP-1b(c38) OS=Triticum aestivum E-value=0; Transcription factor TGA5 OS=Arabidopsis thaliana E-value=0; |
| Length | 1140 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170 (11 ESTs); SRR546165 (5 ESTs); SRR546172 (2 ESTs); SRR546168 (1 ESTs); |
| Sequence | CATAATAGAGATGTAGAATTATTACATCGATGATGATTCTTTCTATTATTAGGAACAAAA |
| EST members of Unigene | SRR546170.127057 SRR546165.87119 SRR546170.26454 SRR546165.209072 SRR546170.155334 SRR546172.4109 SRR546170.26277 SRR546170.25699 SRR546170.7352 SRR546170.98543 SRR546165.155579 SRR546172.117005 SRR546170.71730 SRR546165.104840 SRR546170.104444 SRR546170.42375 SRR546172.135587 SRR546165.127210 SRR546165.115226 SRR546170.2970 SRR546170.84695 SRR546170.81798 SRR546165.125871 SRR546168.54608 SRR546170.92847 SRR546170.134566 SRR546165.204145 SRR546170.5303 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | bZIP |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830586 |
| Trichome-related Gene from Literature | 830586 |