Detail of EST/Unigene TCHL53027 |
Acc. | TCHL53027 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Receptor-like protein kinase FERONIA OS=Arabidopsis thaliana E-value=9e-48; Receptor-like protein kinase ANXUR2 OS=Arabidopsis thaliana E-value=1e-46; Receptor-like protein kinase ANXUR1 OS=Arabidopsis thaliana E-value=1e-44; Receptor-like protein kinase HERK 1 OS=Arabidopsis thaliana E-value=7e-40; Probable receptor-like protein kinase At5g59700 OS=Arabidopsis thaliana E-value=1e-39; |
Length | 913 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170 (4 ESTs); SRR546165 (3 ESTs); |
Sequence | CCGTGATGTTAAGACCACGAATATTCTGTTGGATGATAACTGGGTCGCTAAGGTTTCAGA |
EST members of Unigene | SRR546170.137172 SRR546168.72853 SRR546165.94471 SRR546165.157466 SRR546165.45219 SRR546170.1555 SRR546165.287166 SRR546170.85217 SRR546165.215862 SRR546170.90827 SRR546170.152218 SRR546165.173485 SRR546165.181791 SRR546170.16101 SRR546168.117577 SRR546168.19435 SRR546165.302524 SRR546170.73723 SRR546165.71994 SRR546170.147155 SRR546168.87093 SRR546172.32094 SRR546170.149494 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.7.11.1 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 824318 |
Trichome-related Gene from Literature | 824318 |