Detail of EST/Unigene TCHL53108 |
Acc. | TCHL53108 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 593 nt |
Species | Humulus lupulus |
Belonged EST Libraries | |
Sequence | ACCAAATGATCACATATCGTGGATGAATTAGGTAATTGATAATCTTTCCAACATGCTGTC |
EST members of Unigene | SRR546168.98343 SRR546165.183953 SRR546165.212749 SRR546172.97089 SRR546165.257236 GD252969 SRR546170.27092 SRR546168.100847 SRR546165.206547 SRR546170.86995 SRR546168.44335 SRR546172.89239 SRR546168.11913 SRR546165.251535 SRR546165.250374 SRR546168.118600 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | SRS |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831108 |
Trichome-related Gene from Literature | 831108 |