| Detail of EST/Unigene TCHL53114 |
| Acc. | TCHL53114 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 661 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | |
| Sequence | AGGAAAAAAATTAAATAAACAAAAAGCTTTTGATTATTTTTAGAACTATCGGAAGCCAGA |
| EST members of Unigene | SRR546170.50402 SRR546168.112435 SRR546170.14668 SRR546170.103546 SRR546170.81549 SRR546170.85046 SRR546170.2362 SRR546170.157516 SRR546170.49628 SRR546170.2280 SRR546170.101931 SRR546165.107679 SRR546170.156363 SRR546170.133380 SRR546170.2032 SRR546165.52460 SRR546170.18840 SRR546170.158925 SRR546170.8608 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | MYB |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824739 |
| Trichome-related Gene from Literature | 824739 |