| Detail of EST/Unigene TCHL54148 |
| Acc. | TCHL54148 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Adenylyltransferase and sulfurtransferase MOCS3 OS=Arabidopsis thaliana E-value=0; Adenylyltransferase and sulfurtransferase MOCS3 1 OS=Zea mays E-value=0; Adenylyltransferase and sulfurtransferase MOCS3 2 OS=Zea mays E-value=0; Adenylyltransferase and sulfurtransferase MOCS3 OS=Oryza sativa subsp. japonica E-value=0; Adenylyltransferase and sulfurtransferase MOCS3 OS=Sus scrofa E-value=0; |
| Length | 1667 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (21 ESTs); SRR546172 (19 ESTs); SRR546170 (11 ESTs); SRR546168 (4 ESTs); |
| Sequence | AAAAAAGGAACTTGTATACCAAAACTGCTTATAACTATTCATACATGTCCAAATATGAAA |
| EST members of Unigene | SRR546165.15437 SRR546165.50808 SRR546172.142474 SRR546170.144705 SRR546170.135041 SRR546168.130612 SRR546165.274582 SRR546172.6994 SRR546170.56205 SRR546165.295242 SRR546172.163128 SRR546172.134336 SRR546172.49539 SRR546172.24024 SRR546172.123167 SRR546165.20326 SRR546170.81188 SRR546168.101676 SRR546170.110742 SRR546170.109775 SRR546165.293755 SRR546165.234048 SRR546172.34497 SRR546172.61742 SRR546168.49309 SRR546170.24937 SRR546165.33673 SRR546165.144117 SRR546165.209524 SRR546165.104044 SRR546172.33587 SRR546170.15731 SRR546165.103843 SRR546172.26622 SRR546165.321824 SRR546172.66042 SRR546165.282789 SRR546172.60049 SRR546172.162634 SRR546165.133779 SRR546165.108493 SRR546165.174393 SRR546172.47704 SRR546165.157449 SRR546170.137899 SRR546165.27000 SRR546172.118276 SRR546165.159750 SRR546172.65132 SRR546168.83221 SRR546170.13817 SRR546172.43460 SRR546172.6736 SRR546165.84168 SRR546170.39343 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.7.7.- 2.8.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835604 |
| Trichome-related Gene from Literature | 835604 |