Detail of EST/Unigene TCHL54670 |
Acc. | TCHL54670 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable mannose-1-phosphate guanylyltransferase 3 OS=Oryza sativa subsp. japonica E-value=0; Mannose-1-phosphate guanylyltransferase 1 OS=Arabidopsis thaliana E-value=0; Probable mannose-1-phosphate guanylyltransferase 2 OS=Oryza sativa subsp. japonica E-value=0; Probable mannose-1-phosphate guanylyltransferase 1 OS=Oryza sativa subsp. japonica E-value=0; Probable mannose-1-phosphate guanylyltransferase 2 OS=Arabidopsis thaliana E-value=0; |
Length | 1467 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (26 ESTs); SRR546170 (18 ESTs); SRR546172 (6 ESTs); SRR546168 (6 ESTs); |
Sequence | TAAAGCAATCGAATTGGCCAAACCCGTTCGAATGAAAGAAATACATAAAGAGCGTCTCAG |
EST members of Unigene | SRR546165.59866 SRR546165.86929 SRR546165.317660 SRR546172.129707 SRR546170.15824 SRR546165.260461 SRR546165.14256 SRR546170.146605 SRR546170.101396 SRR546165.119183 SRR546170.3249 SRR546165.189715 SRR546170.50970 SRR546170.132711 SRR546165.176996 SRR546168.112695 SRR546172.13046 SRR546170.119826 SRR546170.85433 SRR546170.35 SRR546165.19909 SRR546165.113243 SRR546165.202710 SRR546170.99309 SRR546170.111676 SRR546165.226293 SRR546165.225903 SRR546165.3689 SRR546165.12796 SRR546172.107978 SRR546168.61142 SRR546170.68277 SRR546165.304422 SRR546165.14358 SRR546170.156957 SRR546168.123155 SRR546170.11273 SRR546165.297261 SRR546168.16297 SRR546172.115683 SRR546165.282378 SRR546165.256131 SRR546172.62378 SRR546165.209608 SRR546165.22531 SRR546172.7519 SRR546170.123766 SRR546168.61947 SRR546165.124933 SRR546165.65598 SRR546165.165706 SRR546170.55740 SRR546168.126275 SRR546165.213429 SRR546170.27917 SRR546170.107906 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00966 mannose-1-phosphate guanylyltransferase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00971 mannose-1-phosphate guanylyltransferase |
EC | 2.7.7.13 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818562 |
Trichome-related Gene from Literature | 818562 |