Detail of EST/Unigene TCHL55130 |
Acc. | TCHL55130 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Metal tolerance protein 11 OS=Arabidopsis thaliana E-value=0; Metal tolerance protein 5 OS=Oryza sativa subsp. japonica E-value=0; Metal tolerance protein 6 OS=Oryza sativa subsp. japonica E-value=0; Metal tolerance protein 10 OS=Arabidopsis thaliana E-value=0; Metal tolerance protein 9 OS=Arabidopsis thaliana E-value=0; |
Length | 1368 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172 (10 ESTs); SRR546170 (9 ESTs); SRR546165 (8 ESTs); SRR546168 (7 ESTs); HLUTR3CH (1 ESTs); |
Sequence | GCCCACCAATGGCGACCTCTCTTGGCGTCTAAACTTCGAAGCCTTTCAGTTATCTAGCGA |
EST members of Unigene | SRR546170.68989 SRR546165.39814 SRR546170.73812 SRR546165.228599 SRR546168.52167 SRR546170.112238 SRR546168.121720 SRR546172.74099 SRR546170.146857 SRR546170.41377 SRR546165.28039 SRR546172.24830 SRR546172.11108 SRR546172.127641 SRR546168.126417 GD251458 SRR546172.122563 SRR546168.35321 SRR546172.165224 SRR546170.103612 SRR546172.83410 SRR546165.151563 SRR546165.245871 SRR546170.24990 SRR546168.81233 SRR546170.118896 SRR546165.189067 SRR546172.21400 SRR546170.113934 SRR546172.31105 SRR546168.113542 SRR546172.13507 SRR546165.26563 SRR546168.20388 SRR546165.233331 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 2.A.4 Cation diffusion facilitator CDF |
Probeset |
|
Corresponding NCBI Gene | 818530 |
Trichome-related Gene from Literature | 818530 |