| Detail of EST/Unigene TCHL55612 |
| Acc. | TCHL55612 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable actin-related protein 2/3 complex subunit 2 OS=Drosophila melanogaster E-value=1e-17; Actin-related protein 2/3 complex subunit 2 OS=Mus musculus E-value=5e-16; Actin-related protein 2/3 complex subunit 2 OS=Pongo abelii E-value=8e-16; Actin-related protein 2/3 complex subunit 2 OS=Homo sapiens E-value=8e-16; Actin-related protein 2/3 complex subunit 2 OS=Bos taurus E-value=8e-16; |
| Length | 1295 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (30 ESTs); SRR546172 (6 ESTs); SRR546168 (1 ESTs); SRR546170 (1 ESTs); |
| Sequence | ATCAAGGTGTTGTTACAATAGATGGAGTGAAGCATTTGTAAGATCTTTGTTACCATGCAA |
| EST members of Unigene | SRR546165.218165 SRR546165.37871 SRR546165.257197 SRR546165.212355 SRR546165.44229 SRR546165.193600 SRR546170.80159 SRR546165.104315 SRR546165.5589 SRR546165.69958 SRR546172.63305 SRR546172.155075 SRR546165.61663 SRR546165.120400 SRR546165.270754 SRR546165.92193 SRR546165.154607 SRR546165.91803 SRR546172.110377 SRR546165.279392 SRR546165.24056 SRR546165.297489 SRR546165.205306 SRR546168.56326 SRR546165.205883 SRR546165.148109 SRR546165.150220 SRR546165.228657 SRR546172.95058 SRR546165.310840 SRR546165.38801 SRR546172.87357 SRR546165.176758 SRR546165.312800 SRR546165.193760 SRR546165.285750 SRR546172.73438 SRR546165.42437 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817902 |
| Trichome-related Gene from Literature | 817902 |