| Detail of EST/Unigene TCHL55871 |
| Acc. | TCHL55871 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 7-methylxanthosine synthase 1 OS=Coffea arabica E-value=5e-79; 7-methylxanthosine synthase 1 OS=Coffea canephora E-value=6e-79; Probable caffeine synthase 3 OS=Coffea arabica E-value=9e-78; Probable caffeine synthase 4 OS=Coffea arabica E-value=5e-76; Theobromine synthase 2 OS=Coffea arabica E-value=4e-74; |
| Length | 1258 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (21 ESTs); SRR546172 (11 ESTs); SRR546168 (1 ESTs); |
| Sequence | AATCATACGAAGAAAAAAATATGGAAGAGAAGCAAGTTCTCCACATGAAAGGTGGTGTCG |
| EST members of Unigene | SRR546165.274590 SRR546172.89523 SRR546172.71159 SRR546172.92806 SRR546172.55503 SRR546165.277662 SRR546165.192846 SRR546172.145766 SRR546165.129084 SRR546165.107052 SRR546165.51401 SRR546165.120002 SRR546172.66751 SRR546165.39848 SRR546165.230587 SRR546172.104586 SRR546165.304508 SRR546172.56259 SRR546172.134619 SRR546172.119749 SRR546165.278740 SRR546165.322615 SRR546168.37015 SRR546165.30637 SRR546165.238764 SRR546165.203587 SRR546172.106659 SRR546165.149715 SRR546165.284211 SRR546165.117414 SRR546165.10740 SRR546165.8606 SRR546165.92676 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838551 |
| Trichome-related Gene from Literature | 838551 |