| Detail of EST/Unigene TCHL56049 |
| Acc. | TCHL56049 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 1234 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168 (12 ESTs); SRR546165 (7 ESTs); SRR546170 (4 ESTs); SRR546172 (2 ESTs); |
| Sequence | CTCTTGTCTGTCTGAGAGAGGAGTCGTGCTTTGATTGAGGTGTTTGGGTGAGTGTACTTT |
| EST members of Unigene | SRR546168.5581 SRR546168.21618 SRR546168.111084 SRR546172.20334 SRR546168.86754 SRR546170.41730 SRR546165.67440 SRR546168.76143 SRR546172.104051 SRR546170.19165 SRR546165.205263 SRR546168.86143 SRR546168.28567 SRR546168.49230 SRR546168.57254 SRR546170.89521 SRR546165.304035 SRR546168.11488 SRR546165.22292 SRR546165.153126 SRR546168.11500 SRR546170.118520 SRR546168.50734 SRR546165.296732 SRR546165.228333 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828267 |
| Trichome-related Gene from Literature | 828267 |