| Detail of EST/Unigene TCHL56129 |
| Acc. | TCHL56129 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase OS=Vanilla planifolia E-value=0; 4-coumarate--CoA ligase 1 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 2 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 1 OS=Solanum tuberosum E-value=0; 4-coumarate--CoA ligase 2 OS=Solanum tuberosum E-value=0; |
| Length | 1226 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (51 ESTs); SRR546172 (14 ESTs); SRR546170 (10 ESTs); SRR546168 (6 ESTs); |
| Sequence | AACATATATATATTTAAGAAATTACATTTCTTGATAACAAAGGGTTTATTAACATTCTTT |
| EST members of Unigene | SRR546165.80169 SRR546165.278637 SRR546170.141018 SRR546172.53579 SRR546165.83270 SRR546165.117278 SRR546165.13704 SRR546165.247538 SRR546165.297759 SRR546165.246747 SRR546165.206541 SRR546165.282666 SRR546165.285761 SRR546165.73197 SRR546165.185666 SRR546168.56009 SRR546165.317460 SRR546170.73587 SRR546172.169697 SRR546172.42197 SRR546165.230924 SRR546165.114225 SRR546168.24965 SRR546165.191914 SRR546165.33271 SRR546172.124744 SRR546170.83503 SRR546165.321783 SRR546165.249325 SRR546165.122723 SRR546165.133738 SRR546170.101816 SRR546170.158824 SRR546165.172949 SRR546172.60172 SRR546165.4425 SRR546165.85421 SRR546170.56242 SRR546165.130448 SRR546172.164942 SRR546165.143724 SRR546172.55192 SRR546172.74338 SRR546170.21901 SRR546165.160659 SRR546165.179210 SRR546165.263279 SRR546170.48194 SRR546172.109723 SRR546172.135035 SRR546172.112599 SRR546168.90694 SRR546168.63244 SRR546165.238902 SRR546170.94145 SRR546170.131627 SRR546165.260359 SRR546172.31627 SRR546165.312335 SRR546165.283355 SRR546165.67329 SRR546172.44220 SRR546165.149877 SRR546165.263714 SRR546165.107563 SRR546165.77036 SRR546172.57208 SRR546165.322849 SRR546165.270298 SRR546165.245371 SRR546165.217511 SRR546165.281281 SRR546165.30060 SRR546165.114677 SRR546168.136326 SRR546165.6072 SRR546165.281467 SRR546165.157986 SRR546165.118360 SRR546168.80305 SRR546165.199340 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
| EC | 6.2.1.12 6.2.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
| Probeset |
|
| Corresponding NCBI Gene | 841593 |
| Trichome-related Gene from Literature | 841593 |