Detail of EST/Unigene TCHL56443 |
Acc. | TCHL56443 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase 1 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 2 OS=Solanum tuberosum E-value=0; 4-coumarate--CoA ligase OS=Vanilla planifolia E-value=0; 4-coumarate--CoA ligase 1 OS=Solanum tuberosum E-value=0; 4-coumarate--CoA ligase 2 OS=Nicotiana tabacum E-value=0; |
Length | 1191 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (21 ESTs); SRR546172 (9 ESTs); SRR546170 (5 ESTs); SRR546168 (5 ESTs); |
Sequence | ATATAATGTTTTACCTTTTTATTCCAAATTAAGAGTGAGTCCAATATGAGAGATGATAAT |
EST members of Unigene | SRR546172.160427 SRR546165.254869 SRR546165.77074 SRR546165.31464 SRR546165.246151 SRR546165.261798 SRR546165.56950 SRR546165.168649 SRR546165.163659 SRR546170.97169 SRR546168.71688 SRR546172.69297 SRR546165.42543 SRR546165.5036 SRR546165.285832 SRR546165.20886 SRR546170.145886 SRR546170.3096 SRR546172.69051 SRR546172.68810 SRR546165.51536 SRR546165.325511 SRR546165.280292 SRR546172.90971 SRR546165.25180 SRR546165.261521 SRR546165.19185 SRR546170.25754 SRR546168.26145 SRR546168.33146 SRR546165.291114 SRR546168.300 SRR546165.197245 SRR546172.97797 SRR546168.67773 SRR546172.145698 SRR546172.61063 SRR546172.110530 SRR546165.189295 SRR546170.125880 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
EC | 6.2.1.12 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
|
Corresponding NCBI Gene | 841593 |
Trichome-related Gene from Literature | 841593 |