Detail of EST/Unigene TCHL56484 |
Acc. | TCHL56484 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 OS=Hevea brasiliensis E-value=0; 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 OS=Gossypium hirsutum E-value=0; 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2 OS=Gossypium hirsutum E-value=0; 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 OS=Solanum tuberosum E-value=0; 3-hydroxy-3-methylglutaryl-coenzyme A reductase OS=Nicotiana sylvestris E-value=0; |
Length | 1184 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (12 ESTs); SRR546172 (6 ESTs); SRR546168 (5 ESTs); SRR546170 (5 ESTs); |
Sequence | TGGGGCAGTGCTGCGAAATGCCTGTTGGGTACGTTCAGATTCCGGTGGGGATCGCGGGTC |
EST members of Unigene | SRR546165.171558 SRR546170.83039 SRR546165.15407 SRR546168.8275 SRR546170.117223 SRR546168.49055 SRR546165.178907 SRR546168.104131 SRR546170.69344 SRR546172.163345 SRR546172.29252 SRR546172.53608 SRR546172.48421 SRR546170.20997 SRR546172.161930 SRR546165.175315 SRR546168.42966 SRR546165.29242 SRR546165.250540 SRR546170.132830 SRR546165.133631 SRR546165.7628 SRR546168.121846 SRR546172.159610 SRR546165.218875 SRR546165.256363 SRR546165.162818 SRR546165.112183 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00021 3-hydroxy-3-methylglutaryl-CoA reductase |
EC | 1.1.1.34 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.6 Resistance-nodulation-cell division factor superfamily RND |
Probeset |
|
Corresponding NCBI Gene | 843982 |
Trichome-related Gene from Literature | 843982 |