| Detail of EST/Unigene TCHL57127 |
| Acc. | TCHL57127 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ABC transporter B family member 1 OS=Arabidopsis thaliana E-value=0; ABC transporter B family member 19 OS=Arabidopsis thaliana E-value=3e-77; ABC transporter B family member 2 OS=Arabidopsis thaliana E-value=2e-74; ABC transporter B family member 10 OS=Arabidopsis thaliana E-value=3e-74; ABC transporter B family member 15 OS=Arabidopsis thaliana E-value=4e-69; |
| Length | 1119 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (12 ESTs); SRR546170 (7 ESTs); SRR546172 (5 ESTs); SRR546168 (5 ESTs); |
| Sequence | ACTTCTTGACCGTAAAACTGAAATCGAACCTGATGATCCAGATGCCACACCAGCTCCCGA |
| EST members of Unigene | SRR546168.120960 SRR546168.59129 SRR546165.118053 SRR546172.144593 SRR546165.89835 SRR546172.115046 SRR546170.166751 SRR546165.97793 SRR546168.54326 SRR546170.145894 SRR546165.57414 SRR546165.230392 SRR546170.64579 SRR546170.9034 SRR546165.29705 SRR546170.60803 SRR546165.28259 SRR546172.35102 SRR546170.67872 SRR546165.46240 SRR546165.2748 SRR546172.107008 SRR546165.306177 SRR546168.67747 SRR546165.237611 SRR546170.158746 SRR546165.115283 SRR546168.39163 SRR546172.123680 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01509 adenosinetriphosphatase; Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05658 ATP-binding cassette, subfamily B (MDR/TAP), member 1; Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05659 ATP-binding cassette, subfamily B (MDR/TAP), member 4 |
| EC | 3.6.3.44 |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea) |
| Probeset |
|
| Corresponding NCBI Gene | 818265 |
| Trichome-related Gene from Literature | 818265 |