Detail of EST/Unigene TCHL57166 |
Acc. | TCHL57166 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Regulator of nonsense transcripts 1 homolog OS=Arabidopsis thaliana E-value=2e-19; |
Length | 1112 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (22 ESTs); SRR546172 (11 ESTs); SRR546170 (6 ESTs); SRR546168 (4 ESTs); HLUTR3CH (1 ESTs); |
Sequence | TATAGTGAGTCGTATTACGGCCGGGGTACTGGAAATGACTTCATGTCTCAGGACTACATG |
EST members of Unigene | SRR546165.296603 SRR546165.290995 SRR546165.130986 SRR546165.19477 SRR546172.157708 SRR546172.128916 SRR546170.57922 SRR546168.64117 SRR546168.46919 SRR546170.137314 SRR546172.21494 SRR546165.234201 SRR546165.12791 SRR546170.155774 SRR546165.200431 SRR546165.42532 SRR546165.92774 SRR546165.1914 SRR546165.14297 SRR546165.270356 GD252358 SRR546165.242955 SRR546172.124644 SRR546165.27127 SRR546172.170957 SRR546168.110789 SRR546165.1770 SRR546172.59266 SRR546168.70597 SRR546170.125451 SRR546170.61883 SRR546172.150454 SRR546172.13668 SRR546172.25464 SRR546170.62880 SRR546172.45609 SRR546165.261389 SRR546172.146467 SRR546165.208986 SRR546165.253437 SRR546165.13224 SRR546165.140388 SRR546165.77765 SRR546165.143664 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834747 |
Trichome-related Gene from Literature | 834747 |