| Detail of EST/Unigene TCHL57193 |
| Acc. | TCHL57193 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | UDP-sugar pyrophosphorylase OS=Arabidopsis thaliana E-value=0; UDP-sugar pyrophospharylase OS=Cucumis melo E-value=0; UDP-sugar pyrophospharylase OS=Pisum sativum E-value=0; UDP-sugar pyrophosphorylase 1 OS=Glycine max E-value=0; UDP-sugar pyrophosphorylase OS=Oryza sativa subsp. indica E-value=0; |
| Length | 1112 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170 (11 ESTs); SRR546168 (9 ESTs); SRR546165 (8 ESTs); SRR546172 (5 ESTs); HLUTR2CH (1 ESTs); |
| Sequence | TTAAAGTGCCACTTAAAGCATAGTTTATCAAATTTCCCATTTGAAATTATTTGTCATAGT |
| EST members of Unigene | SRR546170.45415 SRR546172.38531 SRR546165.295269 SRR546168.119407 SRR546170.144110 GD248138 SRR546168.84424 SRR546168.102619 SRR546168.40992 SRR546172.42221 SRR546170.138157 SRR546168.7960 SRR546165.159651 SRR546165.130278 SRR546170.71723 SRR546168.86807 SRR546165.230128 SRR546168.86738 SRR546170.75806 SRR546165.87807 SRR546170.122379 SRR546170.145375 SRR546170.145959 SRR546168.65613 SRR546170.123575 SRR546172.151872 SRR546170.43403 SRR546165.275527 SRR546165.233013 SRR546172.54326 SRR546170.107764 SRR546165.268566 SRR546168.108731 SRR546172.147436 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835333 |
| Trichome-related Gene from Literature | 835333 |