Detail of EST/Unigene TCHL57287 |
Acc. | TCHL57287 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Protein TRANSPARENT TESTA GLABRA 1 OS=Arabidopsis thaliana E-value=0; WD repeat-containing protein LWD1 OS=Arabidopsis thaliana E-value=9e-98; WD repeat-containing protein LWD2 OS=Arabidopsis thaliana E-value=4e-96; DDB1- and CUL4-associated factor 7 homolog OS=Dictyostelium discoideum E-value=8e-78; DDB1- and CUL4-associated factor 7 OS=Mus musculus E-value=1e-76; |
Length | 1102 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170 (20 ESTs); SRR546172 (16 ESTs); SRR546165 (14 ESTs); SRR546168 (6 ESTs); |
Sequence | CCTCCTCCGGCGACTATCTCCGCCTCTGGGAGGTTCGTGATAACTCGATCGAACCCATCT |
EST members of Unigene | SRR546172.35803 SRR546165.71474 SRR546172.144971 SRR546165.35535 SRR546170.13303 SRR546172.115595 SRR546165.27780 SRR546172.76739 SRR546165.129430 SRR546172.21471 SRR546170.144085 SRR546170.16759 SRR546165.219477 SRR546168.55067 SRR546168.24163 SRR546170.154604 SRR546170.77895 SRR546165.303217 SRR546165.309201 SRR546165.308621 SRR546172.83947 SRR546170.34021 SRR546165.185907 SRR546170.154385 SRR546172.64424 SRR546172.29829 SRR546165.79225 SRR546172.14795 SRR546170.44883 SRR546168.123569 SRR546172.69920 SRR546168.41059 SRR546168.8599 SRR546165.132641 SRR546165.21131 SRR546170.129513 SRR546168.109043 SRR546172.75103 SRR546170.138387 SRR546170.156943 SRR546170.86032 SRR546165.324549 SRR546170.29279 SRR546170.57916 SRR546170.9605 SRR546172.24931 SRR546170.134982 SRR546172.131985 SRR546170.122426 SRR546170.101557 SRR546172.9845 SRR546165.323782 SRR546170.68889 SRR546172.136410 SRR546170.20789 SRR546172.109375 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
Probeset |
|
Corresponding NCBI Gene | 832523 |
Trichome-related Gene from Literature | 832523 |