| Detail of EST/Unigene TCHL57483 |
| Acc. | TCHL57483 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Pyrophosphate-energized vacuolar membrane proton pump OS=Vigna radiata var. radiata E-value=0; Pyrophosphate-energized vacuolar membrane proton pump 1 OS=Arabidopsis thaliana E-value=0; Pyrophosphate-energized vacuolar membrane proton pump OS=Hordeum vulgare E-value=0; Putative K(+)-stimulated pyrophosphate-energized sodium pump OS=Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601) E-value=8e-91; Putative K(+)-stimulated pyrophosphate-energized sodium pump OS=Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130) E-value=8e-91; |
| Length | 1084 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172 (28 ESTs); SRR546165 (19 ESTs); SRR546168 (13 ESTs); SRR546170 (11 ESTs); HLUTR3CH (2 ESTs); |
| Sequence | TGAATTATTAAAATTATTAAACAAAAAAAATCACATATAGCGCTCCTGATAAACTCAAGA |
| EST members of Unigene | SRR546168.28992 SRR546172.39689 SRR546172.127996 SRR546172.50895 SRR546172.169735 GD252713 SRR546165.201370 SRR546168.12565 SRR546165.286572 SRR546170.16798 SRR546165.168108 SRR546168.128878 SRR546165.216803 SRR546172.161007 SRR546165.261626 SRR546170.9438 SRR546170.119363 SRR546172.44343 SRR546165.188427 SRR546165.201397 SRR546168.39086 SRR546165.144972 SRR546172.140780 SRR546170.124073 SRR546170.107259 SRR546168.120028 SRR546172.15164 SRR546172.94017 SRR546165.294720 SRR546172.160669 SRR546168.113649 SRR546170.97788 GD249342 SRR546172.48019 SRR546172.113141 SRR546170.131233 SRR546165.156290 SRR546168.123526 SRR546165.265041 SRR546168.103866 SRR546172.11752 SRR546170.20191 SRR546168.18658 SRR546170.40097 SRR546172.64311 SRR546165.88396 SRR546165.279510 SRR546168.37577 SRR546172.124980 SRR546172.10569 SRR546168.31964 SRR546172.129994 SRR546170.156953 SRR546172.102935 SRR546165.147549 SRR546165.263695 SRR546172.105540 SRR546170.10778 SRR546172.20115 SRR546172.92006 SRR546168.88648 SRR546172.90065 SRR546165.90576 SRR546168.90385 SRR546172.85418 SRR546172.151110 SRR546172.45011 SRR546172.40965 SRR546165.261387 SRR546172.34979 SRR546172.87918 SRR546165.70650 SRR546165.116835 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea); 3.A.10 H+-translocating diphosphatase H+-PPase |
| Probeset |
|
| Corresponding NCBI Gene | 838138 |
| Trichome-related Gene from Literature | 838138 |