| Detail of EST/Unigene TCHL57552 |
| Acc. | TCHL57552 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein HOTHEAD OS=Arabidopsis thaliana E-value=4e-84; (R)-mandelonitrile lyase-like OS=Arabidopsis thaliana E-value=5e-36; (R)-mandelonitrile lyase 1 OS=Prunus serotina E-value=3e-30; (R)-mandelonitrile lyase 4 OS=Prunus serotina E-value=2e-29; (R)-mandelonitrile lyase 2 OS=Prunus serotina E-value=1e-28; |
| Length | 1077 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168 (30 ESTs); SRR546172 (11 ESTs); SRR546170 (11 ESTs); SRR546165 (2 ESTs); |
| Sequence | AACTAGAAATTAAGAACTTACTTTGATCTCAAATATCAGTTCTCATATTCAAGAATCTTG |
| EST members of Unigene | SRR546168.81739 SRR546168.11021 SRR546168.30341 SRR546172.73295 SRR546170.55447 SRR546170.122482 SRR546168.30142 SRR546168.9856 SRR546165.244242 SRR546168.40758 SRR546168.3265 SRR546168.67221 SRR546170.40963 SRR546172.41235 SRR546168.73243 SRR546168.99362 SRR546172.134789 SRR546168.83516 SRR546172.113150 SRR546168.108223 SRR546170.52957 SRR546168.22631 SRR546168.61273 SRR546168.115173 SRR546172.74661 SRR546168.67254 SRR546168.104195 SRR546170.3055 SRR546168.127652 SRR546168.104847 SRR546168.124556 SRR546172.17951 SRR546172.101052 SRR546172.154173 SRR546168.73530 SRR546170.41254 SRR546172.154742 SRR546170.36590 SRR546168.6839 SRR546170.113852 SRR546168.31237 SRR546172.155934 SRR546168.96385 SRR546168.122275 SRR546168.105462 SRR546170.94429 SRR546172.145325 SRR546168.14836 SRR546165.79169 SRR546170.129956 SRR546168.47477 SRR546168.104283 SRR546170.139623 SRR546168.38214 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00108 choline dehydrogenase |
| EC | 1.1.-.- 1.1.99.1 1.1.99.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843628 |
| Trichome-related Gene from Literature | 843628 |