Detail of EST/Unigene TCHL57651 |
Acc. | TCHL57651 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 9-divinyl ether synthase OS=Solanum lycopersicum E-value=1e-70; 9-divinyl ether synthase OS=Solanum tuberosum E-value=2e-70; Allene oxide synthase OS=Parthenium argentatum E-value=1e-69; 9-divinyl ether synthase OS=Nicotiana tabacum E-value=2e-69; Allene oxide synthase, chloroplastic OS=Linum usitatissimum E-value=5e-69; |
Length | 1065 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172 (28 ESTs); SRR546168 (8 ESTs); |
Sequence | AATAGCAATATGTCACTTTATTGTGGTGATGGGCACCAGAAGTGCCCTAGCAATTCTTTA |
EST members of Unigene | SRR546172.27893 SRR546172.38124 SRR546172.55312 SRR546168.122485 SRR546172.134150 SRR546172.7370 SRR546172.78486 SRR546172.155233 SRR546172.106551 SRR546172.30999 SRR546172.43003 SRR546172.111603 SRR546172.56145 SRR546172.160099 SRR546168.69996 SRR546168.92410 SRR546168.134734 SRR546168.78404 SRR546172.110160 SRR546172.167264 SRR546172.93283 SRR546172.40728 SRR546168.80659 SRR546172.126718 SRR546168.83959 SRR546172.35343 SRR546168.119526 SRR546172.12730 SRR546172.99894 SRR546172.42905 SRR546172.66862 SRR546172.116716 SRR546172.12936 SRR546172.49655 SRR546172.120188 SRR546172.22203 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.13.100 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834273 |
Trichome-related Gene from Literature | 834273 |