Detail of EST/Unigene TCHL57660 |
Acc. | TCHL57660 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=2e-90; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-88; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase OS=Protochlamydia amoebophila (strain UWE25) E-value=6e-51; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase OS=Chlamydia pneumoniae E-value=2e-40; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase OS=Chlamydophila felis (strain Fe/C-56) E-value=2e-39; |
Length | 1069 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (16 ESTs); SRR546168 (12 ESTs); SRR546172 (7 ESTs); SRR546170 (2 ESTs); HLUTR3CH (2 ESTs); |
Sequence | AGAAAAACACAAGATGGCGTTACTTGCCATGGAACTTACTTTCTCCACTGCTTCTTTTTC |
EST members of Unigene | SRR546165.79990 SRR546168.98925 SRR546168.34574 SRR546165.135238 GD251915 SRR546172.84277 SRR546168.50015 SRR546165.16372 SRR546165.302224 SRR546165.201737 SRR546168.89901 SRR546165.277342 SRR546165.100510 SRR546170.131021 SRR546165.59150 SRR546165.102819 SRR546165.141286 SRR546168.15491 SRR546168.61793 SRR546172.32277 SRR546165.46700 SRR546172.24112 SRR546168.90903 SRR546168.11105 SRR546168.3754 SRR546170.99762 SRR546168.133597 SRR546165.256877 SRR546172.95393 SRR546168.119318 SRR546165.132656 SRR546172.111314 SRR546172.125411 SRR546165.89205 SRR546165.15953 SRR546165.120877 SRR546172.2480 SRR546168.56729 GD250524 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 814779 |
Trichome-related Gene from Literature | 814779 |