| Detail of EST/Unigene TCHL57669 |
| Acc. | TCHL57669 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Partner of Y14 and mago OS=Danio rerio E-value=1e-07; Partner of Y14 and mago OS=Culex quinquefasciatus E-value=2e-07; Partner of Y14 and mago OS=Homo sapiens E-value=5e-07; Partner of Y14 and mago OS=Bombyx mori E-value=5e-07; Partner of Y14 and mago OS=Xenopus laevis E-value=1e-06; |
| Length | 1067 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168 (22 ESTs); SRR546165 (20 ESTs); SRR546170 (13 ESTs); SRR546172 (10 ESTs); |
| Sequence | GAGAATGGAGAAGCTGTAGAAGTAGTACAAACTCACGCAGTAGTACCATCACCACCTCGA |
| EST members of Unigene | SRR546165.325212 SRR546165.101820 SRR546168.55842 SRR546168.58937 SRR546168.34788 SRR546172.97658 SRR546168.87714 SRR546170.20651 SRR546172.27873 SRR546168.59111 SRR546172.154625 SRR546168.70122 SRR546170.50010 SRR546165.232242 SRR546168.53490 SRR546168.80969 SRR546165.229961 SRR546170.120994 SRR546168.128549 SRR546170.155382 SRR546165.80615 SRR546165.11619 SRR546165.1736 SRR546170.155758 SRR546170.39642 SRR546172.47439 SRR546165.304182 SRR546168.88721 SRR546172.157763 SRR546168.98753 SRR546172.67322 SRR546172.136734 SRR546172.67272 SRR546168.117149 SRR546170.95726 SRR546170.82978 SRR546165.203375 SRR546168.23475 SRR546168.61727 SRR546170.88563 SRR546168.120648 SRR546172.26606 SRR546165.150211 SRR546165.316777 SRR546168.73105 SRR546170.93374 SRR546172.124570 SRR546165.302083 SRR546168.81838 SRR546170.55551 SRR546168.4601 SRR546165.145067 SRR546168.107567 SRR546170.7280 SRR546168.50755 SRR546165.3572 SRR546165.178865 SRR546168.118763 SRR546165.77981 SRR546165.218847 SRR546165.113525 SRR546165.96913 SRR546165.290158 SRR546168.29486 SRR546170.55374 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837682 |
| Trichome-related Gene from Literature | 837682 |