Detail of EST/Unigene TCHL57717 |
Acc. | TCHL57717 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=2e-99; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=5e-97; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=2e-92; Cinnamyl alcohol dehydrogenase 7 OS=Arabidopsis thaliana E-value=1e-90; Cinnamyl alcohol dehydrogenase 8 OS=Arabidopsis thaliana E-value=2e-89; |
Length | 1061 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168 (26 ESTs); SRR546172 (9 ESTs); |
Sequence | ATTGCAGCAACGACCTCGAGAACTACTGCCCCAAGATGGTACTCACCTACGGTGGCGCCA |
EST members of Unigene | SRR546172.39490 SRR546172.123740 SRR546168.13721 SRR546168.42893 SRR546168.6368 SRR546168.1724 SRR546168.61623 SRR546168.60679 SRR546168.58942 SRR546172.37757 SRR546172.36985 SRR546168.25149 SRR546168.65154 SRR546168.45062 SRR546168.15707 SRR546168.106518 SRR546168.53310 SRR546172.84075 SRR546168.100619 SRR546168.19586 SRR546172.130191 SRR546168.114092 SRR546172.129816 SRR546168.8795 SRR546168.3381 SRR546168.22139 SRR546168.23109 SRR546168.79915 SRR546168.132891 SRR546172.24342 SRR546168.62735 SRR546168.27371 SRR546168.26791 SRR546172.123660 SRR546168.90352 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829954 |
Trichome-related Gene from Literature | 829954 |