| Detail of EST/Unigene TCHL57756 |
| Acc. | TCHL57756 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | High-affinity nitrate transporter 3.1 OS=Arabidopsis thaliana E-value=8e-48; High-affinity nitrate transporter 3.2 OS=Arabidopsis thaliana E-value=4e-44; |
| Length | 1060 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170 (38 ESTs); SRR546172 (7 ESTs); SRR546165 (5 ESTs); SRR546168 (2 ESTs); |
| Sequence | ATTCTATAATGTATCTTATTTTATTTCTTTAAGACATAAAAGTAAAATTTTCAACTTGCC |
| EST members of Unigene | SRR546170.42684 SRR546165.134101 SRR546168.26481 SRR546170.34014 SRR546172.107877 SRR546170.12921 SRR546172.45066 SRR546172.28637 SRR546170.21605 SRR546170.93669 SRR546172.19732 SRR546170.140271 SRR546165.139730 SRR546170.165220 SRR546170.12994 SRR546170.18011 SRR546170.113643 SRR546170.11630 SRR546165.15486 SRR546165.77322 SRR546170.152087 SRR546170.95467 SRR546170.35194 SRR546170.134488 SRR546170.140475 SRR546170.67003 SRR546172.131135 SRR546170.55175 SRR546170.72942 SRR546170.12267 SRR546170.2220 SRR546170.67908 SRR546170.96681 SRR546168.54192 SRR546172.96965 SRR546170.59783 SRR546170.3545 SRR546170.112501 SRR546170.11317 SRR546170.111977 SRR546170.95976 SRR546170.53670 SRR546170.105445 SRR546170.1106 SRR546170.99248 SRR546170.116632 SRR546172.64934 SRR546170.64271 SRR546170.97110 SRR546165.236265 SRR546170.85324 SRR546170.91500 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 8.A.2 Secretin auxiliary lipoprotein SAL |
| Probeset |
|
| Corresponding NCBI Gene | 835085 |
| Trichome-related Gene from Literature | 835085 |