| Detail of EST/Unigene TCHL57799 |
| Acc. | TCHL57799 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=0; Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=0; Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=0; Uncharacterized protein L780 OS=Acanthamoeba polyphaga mimivirus E-value=4e-44; |
| Length | 1050 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168 (15 ESTs); SRR546172 (8 ESTs); SRR546170 (7 ESTs); SRR546165 (2 ESTs); |
| Sequence | GTCGGCATAAATGATAATAATTTCAATAAATTAGAAAAGTTACATGGCCAGAAAGTTATT |
| EST members of Unigene | SRR546168.63177 SRR546170.117246 SRR546168.34565 SRR546168.38426 SRR546168.123048 SRR546168.64690 SRR546172.24225 SRR546172.153114 SRR546172.22876 SRR546168.65530 SRR546168.121778 SRR546170.45261 SRR546168.91644 SRR546165.43330 SRR546170.143019 SRR546172.86197 SRR546168.90769 SRR546172.55774 SRR546168.59189 SRR546170.69240 SRR546165.151761 SRR546168.115818 SRR546172.146804 SRR546170.51665 SRR546168.90318 SRR546168.59993 SRR546168.17347 SRR546172.102417 SRR546172.6349 SRR546170.52086 SRR546168.107927 SRR546170.164916 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844193 |
| Trichome-related Gene from Literature | 844193 |