Detail of EST/Unigene TCHL58074 |
Acc. | TCHL58074 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized WD repeat-containing protein alr2800 OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=4e-15; F-box/WD repeat-containing protein 7 OS=Drosophila melanogaster E-value=1e-14; Probable E3 ubiquitin ligase complex SCF subunit sconB OS=Arthroderma otae (strain ATCC MYA-4605 / CBS 113480) E-value=2e-14; Outer row dynein assembly protein 16 OS=Chlamydomonas reinhardtii E-value=5e-14; Probable E3 ubiquitin ligase complex SCF subunit sconB OS=Trichophyton verrucosum (strain HKI 0517) E-value=7e-14; |
Length | 1028 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172 (20 ESTs); SRR546165 (8 ESTs); SRR546170 (6 ESTs); SRR546168 (2 ESTs); |
Sequence | ATGTCAGAACAGACACTTGTGTGGCAACTGTTGGTCGTTGTACTAGTGCAGTTTTATGCA |
EST members of Unigene | SRR546172.13784 SRR546172.6232 SRR546170.147984 SRR546172.49679 SRR546165.239178 SRR546172.148024 SRR546172.39621 SRR546172.168183 SRR546172.5670 SRR546172.79884 SRR546172.34868 SRR546172.4903 SRR546165.68996 SRR546172.46468 SRR546165.177818 SRR546168.39664 SRR546165.134153 SRR546168.63318 SRR546170.22149 SRR546172.135191 SRR546172.47272 SRR546172.3790 SRR546165.201036 SRR546170.115416 SRR546172.7674 SRR546170.10905 SRR546172.9227 SRR546165.110616 SRR546172.120361 SRR546170.61953 SRR546165.195086 SRR546165.208024 SRR546170.54397 SRR546172.164994 SRR546172.12718 SRR546172.116497 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K10260 F-box and WD-40 domain protein 7 |
EC | 6.3.2.19 |
Transcription Factor Family | C3H |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841327 |
Trichome-related Gene from Literature | 841327 |