Detail of EST/Unigene TCHL58434 |
Acc. | TCHL58434 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoenolpyruvate carboxylase OS=Solanum tuberosum E-value=0; Phosphoenolpyruvate carboxylase 1 OS=Arabidopsis thaliana E-value=0; Phosphoenolpyruvate carboxylase OS=Nicotiana tabacum E-value=0; Phosphoenolpyruvate carboxylase 2 OS=Sorghum bicolor E-value=0; Phosphoenolpyruvate carboxylase, housekeeping isozyme OS=Glycine max E-value=0; |
Length | 996 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172 (10 ESTs); SRR546165 (10 ESTs); SRR546168 (10 ESTs); SRR546170 (10 ESTs); HLUTR3CH (2 ESTs); |
Sequence | GTTCCATTGTCTTCAAAGAACCCCGTTTTGTTGAGTACTTCCGCCTGGCTACACCGGAGT |
EST members of Unigene | SRR546165.47512 SRR546172.141292 SRR546172.32496 SRR546165.84396 SRR546168.81886 SRR546165.136179 SRR546172.99529 SRR546172.97598 SRR546170.84177 SRR546165.79413 SRR546170.6374 SRR546172.47648 SRR546170.23408 SRR546170.116532 SRR546170.122131 SRR546168.17808 SRR546172.70423 SRR546168.5823 SRR546165.21835 SRR546165.86183 SRR546172.46382 SRR546172.23569 SRR546165.200285 SRR546172.40355 SRR546170.117358 GD249125 SRR546170.147302 SRR546170.125065 SRR546168.50114 SRR546168.29827 SRR546168.114058 SRR546170.60383 SRR546168.79133 SRR546165.229887 SRR546168.107746 SRR546172.49266 SRR546168.134414 SRR546170.18266 SRR546165.221756 SRR546168.97490 SRR546165.37783 GD250160 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841765 |
Trichome-related Gene from Literature | 841765 |