| Detail of EST/Unigene TCHL58583 |
| Acc. | TCHL58583 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Syntaxin-121 OS=Arabidopsis thaliana E-value=1e-89; Syntaxin-125 OS=Arabidopsis thaliana E-value=5e-76; Syntaxin-124 OS=Arabidopsis thaliana E-value=3e-75; Syntaxin-122 OS=Arabidopsis thaliana E-value=9e-75; Syntaxin-123 OS=Arabidopsis thaliana E-value=3e-67; |
| Length | 985 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170 (24 ESTs); SRR546165 (11 ESTs); SRR546172 (11 ESTs); SRR546168 (2 ESTs); HLUTR3CH (1 ESTs); |
| Sequence | TAATAAATATATATTTATATATAAGTAACAAATCTCATGAAAGAATACACAAATAACAAC |
| EST members of Unigene | SRR546172.89911 SRR546170.111074 SRR546165.315533 SRR546170.97349 SRR546165.32435 SRR546170.9051 SRR546165.263549 SRR546170.6337 SRR546170.115686 SRR546168.39579 SRR546172.79859 SRR546165.212171 SRR546170.34200 SRR546170.33277 SRR546172.53440 SRR546165.162354 SRR546172.62901 SRR546170.160204 SRR546170.111886 SRR546165.146495 SRR546170.85608 SRR546172.157754 SRR546172.107137 GD249593 SRR546165.275328 SRR546170.39177 SRR546172.113210 SRR546172.47303 SRR546170.51481 SRR546165.218819 SRR546172.125545 SRR546165.88955 SRR546172.19251 SRR546165.168373 SRR546170.14740 SRR546170.91049 SRR546170.69077 SRR546170.50532 SRR546168.18086 SRR546170.122636 SRR546170.141371 SRR546170.39557 SRR546172.95862 SRR546170.38392 SRR546170.122621 SRR546165.44182 SRR546170.160487 SRR546170.80481 SRR546170.146165 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04130 SNARE interactions in vesicular transport > K04560 syntaxin 1A; Genetic Information Processing > Folding, Sorting and Degradation > ko04130 SNARE interactions in vesicular transport > K08486 syntaxin 1B/2/3/4 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820355 |
| Trichome-related Gene from Literature | 820355 |